While it has been stunningly predictive and useful, quantum mechanics, because of its inherent peculiarity, has been a gold mine for new age hucksters such as Deepak Chopra. Albert Einstein himself couldn’t accept the theory which allowed for particles to take all possible paths from point A to point B and for cats to be both dead and alive at the same time. His aversion to this theory was immortalized in the quote, “God doesn’t play dice,” alluding to the strange universe ruled by random events that quantum mechanics was describing. To quote the physicist Richard Feynman, who made great strides in the field of quantum mechanics, “If you think you understand quantum theory, then you don’t understand quantum theory.”
Feynman’s fellow Nobel laureate, Luc Montagnier, who won the prize for establishing that AIDS was caused by HIV, recently published a paper, entitled “DNA waves and water,” which claims that through the use of electromagnetic fields, DNA molecules, the stuff of life, can “teleport” from one test tube to another. The mechanism this takes is, according to the paper, within the “framework of quantum field theory.”
Montagnier’s experimental setup included two test tubes, one containing pure water, and the other containing a highly diluted sample of a fragment of DNA from the human immunodeficiency virus (HIV). After applying a 7 Hz electromagnetic field for 18 hours to both the tube that contained pure water, and the other tube that contained DNA, the tubes were then subjected to a process called polymerase chain reaction (PCR). This procedure takes DNA molecules present in a sample and copies them continuously, based on a particular defined DNA sequence. Their results showed that the pure water miraculously produced DNA, when there should have been none.
This is a stunning result—so stunning that it seems rather dubious. The claim posited here is that dilute quantities of DNA can somehow emit “DNA waves” via its natural electromagnetic field and that this signal mimics the exact DNA sequence of the source in water. This signal can supposedly imprint itself into water. Such an outlandish declaration just cannot avoid comparisons to homeopathy. The paper’s conclusion also favors a rather convoluted solution (DNA waves) over a much more simple explanation: contamination. The retention of an electromagnetic field in the absence of the signal source is, however, entirely possible within quantum mechanics, though only in the order of picoseconds (one trillionth of a second)—certainly not enough time for a PCR reaction to take place (which usually takes about an hour).
The nature of PCR is that it is so effective at making copies of DNA that even just one molecule of DNA can be amplified. Imagine thousands of photocopiers that randomly take any page in their vicinity and copy them. Even if you just had one page to be copied, such a sheet containing the letter “X”, you could create millions of copies of this letter in no time since the copies of that page will be used by the other photocopiers to make even more copies—a chain reaction. Now, let’s say that just one stray sheet with the letter “Y” accidentally flew into the copier room. By the end of your copying, you’d have yourself billions of sheets with either “X” or “Y”. That’s how even one tiny splatter of contaminating DNA (from instruments used or even one’s own hands) can ruin an experiment.
Messing up a PCR experiment is so easy that Montagnier’s observation has to be reproduced by other scientists before it can even be taken seriously. The only reason it seems to be grabbing headlines is that Montagnier is a Nobel laureate. But, Nobel laureates are vulnerable to the dreaded “Nobel disease,” when noted scientists who have won the prize later support pseudoscientific ideas.
The originator of PCR, Kary Mullis, also won the Nobel prize, only to go on to deny the link between HIV and AIDS. Another laureate, Linus Pauling, who won two Nobel prizes, promoted the quackery that vitamin C treated cancers and prevented colds, late in his career.
However, regardless of accusations of Nobel disease, Montagnier’s ideas shouldn’t be dismissed offhand. If his observations can be consistently replicated by other researchers (and contamination is ruled out), then a revolution will occur in biology and all of science. It’s a prospect one can’t help but be excited about, but wonder should always be coupled with skepticism.
—Continued from previous post—
3) There is much ado on this site and elsewhere about the notion that phenomena classified as "quantum" are by definition of short duration and/or of infinitesimal size; the assertion is always varying versions of "Quantum phenomena do not persist longer than infinitesimal fractions of a second.” I also want to more specifically address an idea in the above article regarding signal retention in absence of the signal source.
This is, in point of fact, NOT what Montagnier is claiming. His paper describes and supports a theory regarding the proposed ability of water molecules which are in appropriate electromagnetic contact with DNA to create what he calls "nanostructures". He goes on to state that "In the case of bacteria, EMS [electromagnetic signals] are produced by 100 nm filtrates and not by 20 nm filtrates, indicating that the size of the structures producing EMS is ranging between 20 and 100 nm." The proposed mechanism for transfer of DNA information is NOT simply quantum mechanical descriptions of signal retention, it is rather that “the water nanostructures and their electromagnetic resonance can faithfully perpetuate DNA information” under appropriate conditions. Essentially, the idea is that when placed under an electromagnetic field oscillating at 7Hz for a period of about 18 hours at room temperature, these nanostructures resonate and cause the pure water in the other tube to create similar microstructures, which then serve to somehow activate the PCR process in a way that produces DNA almost identical to the original strand(s). The process is superficially similar in concept to a tuning fork or the process by which a permanent magnet or an electric current can be used to magnetize an ordinary piece of iron.
Besides the fact that what we are talking about is arguably as much an electromagnetic and chemical phenomenon as it is a quantum phenomenon, you have to remember that even extremely short, barely detectable, and overtly random quantum phenomena have the potential to cause a cumulative change/pattern that is quite persistent and obvious. Think of double-slit electron self-interference experiments; the PERSISTANT image (recorded over relatively long periods of time) on the reactive material is of an interference pattern that attests to the CUMULATIVE effect of electrons interfering with themselves (something which occurs over typical quantum mechanical timescales).
———-
4) As for the assertion that there were no negative controls, I offer in rebuttal yet another quote directly from the study in question, which specifically lists the negative controls used:
“The following controls were found to suppress the EMS transmission in the water tube:
– Time of exposure of the two tubes less than 16 − 18 hrs
– No coil
– Generator of magnetic field turned off
– Frequency of excitation < 7 Hz
– Absence of DNA in tube 1.”
The nature and variety of the negative controls shown to suppress transmission make it highly unlikely that contamination is causing reliable false positives in the absence of negative controls.
———-
In conclusion, I have to say that I am saddened and yet not surprised at the reception Montagnier’s paper has received. I have been excitedly waiting for anyone to publish anything that actually contains an attempt to experimentally verify the ideas in it, but so far I have found nothing. Most of what I do find are articles like this one, which lambaste the study without even being very familiar with it. They usually end the article by saying something regarding scientific notions not being dismissed outright due to sounding implausible, but this, of course, comes after many paragraphs of dismissive insinuation, barely contained laughter, and/or inflammatory language. Perhaps I will have to wait until Montagnier and his team publish the further information and extended studies promised at the end of this paper. I don’t pretend to know whether the data in the study is accurate and reproducible, but I believe that, as a Nobel laureate and as a human being, Montagnier deserves that we return some of the effort into examining his ideas that he and his team clearly spent creating them. It is, to be frank, quite inconsiderate and unprofessional to critique someone’s work without even having read it carefully.
Science has a dirty little secret – it doesn’t matter how accurate a notion is or is not if nobody will give it a chance. Perhaps Mr. Bercero would like to reread this particular study and repost new comments? Or perhaps not.
1) We never see this gel or this sequence.
2) This was a fault in my writing, absolutely. In an attempt to make the article interesting and accessible to the masses, I used such words, which Montagnier would probably never use to describe his work. I do think they convey the message, however, to the uninitiated.
3) This is all interesting, but, really, the paper never showed anything remotely supporting such conjectures. They merely proposed a possible framework that could explain their observations, which are really more easily explained by contamination. I would truly love to see confirmation of Montagnier's experiment, but I am simply not buying the whole nanostructures quantum field thing, not yet, at least. I share your excitement to hear anything that would corroborate this study.
4) Yes, and where were the results of these tests? They merely state that these suppressed the "EMS transmission" if it even happened at all.
Ultimately, it's an extraordinary claim backed by no extraordinary evidence. Let's see more about this study and, if it is confirmed by peer review, then I will clap my hands red for Montagnier and his team.
I will certainly grant you that the amount of raw data in the paper is not sufficient to fully support such impressive claims; of course, even if there were copious amounts of data, claims this extraordinary would still require extensive peer verification. There is more data in the paper than you give it credit for, but really this is almost a moot point. My issue is not in how convinced you are or are not, because, to be honest, neither one of our opinions really matters; all that matters is whether it is reproducible. What I am suggesting is that the simultaneously strange and all-too familiar claims in Montantier’s paper are having the widespread effects of blinding people to what actually is and is not in the paper, and of causing unthinking, knee-jerk reactions (both positive and negative). Let me ask you this: would it have satisfied you to see some data which could have so easily been faked? If you saw a gel or a sequence it would almost certainly look just like any gel or sequence produced from a strand of actual, physical DNA; if they looked somehow strange or different, it stands to reason that Montagnier would likely have mentioned it in at least one place in the paper. What is convincing about a photograph of agarose gel? What is there to make you assume that a long series of letters is, in fact, the genetic sequence for DNA which has been recovered from a tube that did not contain physical DNA fragments before undergoing the PCR process?
Regardless, this is not how you framed your comments previous to the reply you made on my first posts. You actually specifically said "There doesn't seem to be anything about sequencing the amplified DNA in the paper. There were also no negative controls. Overall, it just seemed like a very bad experiment mixed with a lot of impressive sounding pseudoscience." If you would like to see some numbers/pictures/tables for certain specific topics but didn't find them, that is a very different issue than the paper simply not containing “anything about" these topics. Personally, I too would very much like to have seen specific numbers rather than a general claim of "suppression" for the negative controls. I feel I must, however, still raise issue with your ready suggestion of contamination; I will agree wholeheartedly that this is indeed a possibility, but if we are to take Montagnier as being anything other than a liar, fraud, or complete quack we must consider very strongly the negative controls in place and the reproducibility demonstrated in their experimentation. Twelve trials is, to be sure, fewer than I personally would have liked to see, but at the same time 12 out of 12 positives vs “suppression” (whatever that may mean in quantitative terms) is notable even if we chose to err on the side of caution a bit and assume that the ambiguous language can be taken to mean that some of the negative controls produced positive results as well. Even if we all agreed to reject Montagnier’s theoretical underpinnings, I would still want to see evidence and/or an explanation for what process or specific experimental error IS at work to produce these results. There is, of course, more justification than this for specifically considering Montagnier’s proposed explanation, but it is all in the paper for anyone to read. It is important to be able to separate the quality of the paper from the quality of the experiment — scientists, mathemeticians, and engineers are not on the whole known for their stellar achievements in clear and artful communication. Moreover, if you think every well-respected scientific paper necessarily has tables upon tables full of raw data, you are mistaken, although I don't think you would go so far as to claim that. Montagnier himself says near the end of the paper "There are of course many unresolved questions raised by our findings, which deserve more work and more interactions." I think if he wanted you to be steadfastly convinced by the end of the paper it would have been much longer. This paper is not supposed to be Origin of Species, and judging by his language more data should be forthcoming.
I respect that you are attempting to make a highly technical paper accessible to laypersons. It is a truly noble endeavor. However, you are radicalizing and misrepresenting the content when you suggest that "The experiment actually used PCR to (questionably) show that DNA can travel through solid objects…" This is why I suggested the tuning fork and magnetization comparisons, while being extremely careful to specifically stress that they are ONLY SUPERFICIAL COMPARISONS.
It is also worth noting that the theoretical framework is not entirely theirs, but borrows in part from other (new, and not widely known or entirely understood) notions of water dynamics and interactions. Therefore, it is to be expected that some of the ideas will seem strange and unlikely even for — perhaps especially for — seasoned scientists. This always happens to some degree with radical new ideas both right and wrong, and is not by any means an indicator of the idea’s accuracy or lack thereof.
— Continued on next post. These length limitations are killing me. 🙂 —
— Continued from previous post —
I will be honest with you. I am somewhat picking on you specifically because I am frustrated with the treatment this study has received in general. As a highly educated person whose function it is — at least in part — to bring scientific knowledge to a wider audience, it is your responsibility to be, for lack of a better word, careful. The words you use MATTER. When 90 out of 100 science writers either glance at something and dismiss it or simply copy and paste each other’s scorn, you have fairly effectively made it less likely to be studied or even looked at seriously. Standard boilerplate about postponing judgment does nothing to hide the judgment apparent in statements like “Overall, it just seemed like a very bad experiment mixed with a lot of impressive sounding pseudoscience.”
I fully expect that no-one or almost no-one will make any significant effort to test Montagnier's claims until he has published much more on the subject, for the simple reason that mainstream opinion of this study is quite dismissive and most scientists either will not or cannot afford to risk their reputations on something that is generally seen as being on the fringe. Luckily, judging by comments in his paper his team is likely un-phased and currently at work implementing and further testing the notions contained therein.
I admit that I approached Montagnier's paper with a higher dose of skepticism than I would, say, a paper on the structural characterization of a protein. I probably wouldn't care to read all the measurements of the latter. It is just that what Montagnier reported was so beyond what we now know that I believe it warrants a deeper look into it. I wouldn't go as far as accuse the team with fraud. I do not think that would be fair, which is why I would trust even the chromatogram of the PCR products. At the very least, I'd like to see the values here. I simply cannot buy a mere mentioning of what they say they did. The claims put forward in their research are simply too great for the sparseness of the evidence they show especially in an age where hucksters abound selling homeopathy and quantum healing. The empirical support for the paper is disappointing for a researcher of his stature, from whom it is valid to expect much more.
That being said, I am completely open to being proven wrong and I promise that you'll see here a full retraction (and celebration of a truly astounding discovery) if and when that does happen.
That is perfectly reasonable. Thank you for rephrasing. It is refreshing to find someone who actually checks and responds to comments on their threads, and I must say I am glad to know that I have the option of actively discussing any possible future developments here.
I'm new to this and your comments have been exceedingly helpful. I hope I only get better with my succeeding forays into this kind of writing. I do look forward to further correspondence with you, sir.
Before I discuss its content, here is a site from which you can download the original text of the paper in question:
http://arxiv.org/abs/1012.5166
I highly recommend that anyone who is even the slightest bit curious read the paper themselves. It is only 10 pages long, and while some of the language is highly technical, it is still readable in the sense that you should at least be able get the general idea out of even the thickest bits.
Now, to business. I would like to reply to a few questions and assertions I have seen on this site. I apologize in advance for the length of this post.
———-
1) In regards to the question about whether or how Montagnier’s team tested the amplified DNA, I offer one of several relevant quotes from the paper itself:
[The amplified DNA was] "submitted to electrophoresis in an agarose gel. The result was that a DNA band of the expected size of the original LTR fragment was detected. It was further verified that this DNA had a sequence identical or close to identical to the original DNA sequence of the LTR. In fact, it was 98 % identical (2 nucleotide difference) out of 104. This experiment was found to be highly reproducible (12 out of 12) and was also repeated with another DNA sequence from a bacterium, Borrelia burgdorferi, the agent of Lyme disease."
———-
2) Just for the record, the words "teleport,” "teleportation," “transport,” “magic,” and “miraculous” are nowhere to be found in the published paper. Not one single instance of any of those words. It is emphatically NOT Montagnier’s claim that DNA’s actual physical material is somehow transported through a solid barrier into another container. However, it seems to be an unwritten rule that articles written ABOUT the published paper must include at least one of those words in the title.
———-
—Please continue reading on the next post—
Haha! i wonder if he's sequenced the amplified DNA afterwards to see if its the same with that from the first test tube.
There doesn't seem to be anything about sequencing the amplified DNA in the paper. There were also no negative controls. Overall, it just seemed like a very bad experiment mixed with a lot of impressive sounding pseudoscience.
Hey Garrick, can you expound more on the PCR procedure in layman's terms? As I understood the wiki link, the PCR requires that you provide "raw materials" in the form of nucleotides in the target location so that the PCR has some building blocks to work with.
The statement "results showed that the pure water miraculously produced DNA, when there should have been none" seems to be a bit of a sensationalism. As I understood it, the experiment *may* indicate that an electric current can be used as a medium to transmit the gene templating information, or that water can somehow retain such information that can later be retrieved and used as a template for PCR to use.
So, PCR works by, first, knowing the first few and last few letters composing a gene. You create DNA fragments with these letters, they are called "primers". When you mix these primers in with DNA (such as from blood samples or viruses), which contain ends that match the primers you created, an enzyme or catalyst called "DNA polymerase" fills in the gap between the primers. This goes on at an exponential rate.
Example:
Your gene of interest has this sequence (note that DNA is a double helix with letters composing each side):
ACGTAGCGCCGATCGATCGATCGACTCAGACTCATGCA (template strand)
TGCATCGCGGCTAGCTAGCTAGCTGAGTCTGAGTACGT (complementary strand)
A always pairs with T
C always pairs with G
So, you make primers that will pair with the first few letters of the template like: TGCATCG
And primers that pair with the last few letters of the complementary strand like: CATGCA
DNA Polymerase will complete the gene starting from the primers you made (it only goes one direction, which is why you need to know both ends.)
ACGTAGCGCCGATCGATCGATCGACTCAGACTCATGCA
TGCATCG—————————————————————>
TGCATCGCGGCTAGCTAGCTAGCTGAGTCTGAGTACGT
<———————————————————————–CATGCA
This will produce the complete gene since complementary strands are attracted to each other. The reaction proceeds using the products of the previous reaction, which resulted from the reaction before it—a chain reaction.
That's how pure water "miraculously produced DNA." The gene from one tube somehow translocated to the other tube and was used by DNA polymerase as a template. So, you're not wrong in your understanding of the paper's claim that genetic information can be somehow transmitted via magnetic fields. Then this information somehow resulted in the production of a DNA product via PCR. This should not have happened because DNA is a large molecule composed of matter particles. It that should not be able to travel intact between solid objects as electromagnetic waves, at least, not in everyday conditions.
hmm, so in normal PCR, you need to make a whole "reverse gene" that will become the template/mold ? the part I got lost was during the templating. In this new experiment, do you still need to introduce primers into the "pure water" subject?
which part of the normal PCR procedure does this experiment not need to do anymore?
In normal PCR, you need to synthesize both the forward and reverse sequence of a gene. Both actually are used as templates, though my labeling was probably misleading in showing that only one was a template. Just imagine that there are two sides in every reaction. One side, the forward gene is the template, on the other side, the reverse gene is the template. Then the same principle applies.
They didn't put primers in the pure water tube until after exposing it to the low frequency magnetic field. Since the primers should not have been able to attach to a complete gene in the pure water tube, there should be no template to fill the gaps between the primers. And, there should have been no gene copies produced.
The experiment actually used PCR to (questionably) show that DNA can travel through solid objects, so the standard PCR procedure was not modified.